HUGE

Gene/Protein Characteristic Table for KIAA1596

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04983
Accession No. :	AB046816
Description :	Fanconi anemia group M protein.
HUGO Gene Name :
Clone Name :	fj09605 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4696 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 876 bp

Genome contig ID gi51511730f_44614086
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
CAGGACTGTGAGTCAATTAAACATCTTTTCCTTAT
Flanking genome sequence
(125753 - 125802)
----+----*----+----*----+----*----+----*----+----*
AAATTACCCAGTCGGGTTATTTCTTCATAGCAGCGTGAGAATGGACTAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 44714086 44739837 11 99.8 Internal No-hit

Features of the protein sequence	Description

Length: 1151 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65783	99.8	Fanconi anemia,...	Homo sapiens
AAI40777	99.8	FANCM protein [...	Homo sapiens
Q8IYD8	99.8	Fanconi anemia ...	Homo sapiens
XP_509928	98.9	Fanconi anemia,...	Pan troglodytes
XP_001096470	93.0	similar to Fanc...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006166 922 1005 PF02732 DNA repair nuclease

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006166	922	1005	PF02732	DNA repair nuclease

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGAAGTCCAGTCTACCACAC

Primer_r
: AAGAGAAGTATGTGTCCCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: CCR
Primer_f	: AATCGCATGGTGGTGGAAAGG
Primer_r	: CTGTCATAGCTCTTTGTTCTC
PCR product length	: 185 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	876 bp
Genome contig ID	gi51511730f_44614086
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAGGACTGTGAGTCAATTAAACATCTTTTCCTTAT
Flanking genome sequence (125753 - 125802)	----+--------+--------+--------+--------+----* AAATTACCCAGTCGGGTTATTTCTTCATAGCAGCGTGAGAATGGACTAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	44714086	44739837	11	99.8	Internal No-hit

Primer_f	: ATGAAGTCCAGTCTACCACAC
Primer_r	: AAGAGAAGTATGTGTCCCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1596

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information