HUGE

Gene/Protein Characteristic Table for KIAA1574

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04964
Accession No. :	AB046794
Description :	Protein FAM29A.
HUGO Gene Name :	family with sequence similarity 29, member A (FAM29A)
Clone Name :	fh24775 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5214 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3199 bp

Genome contig ID gi89161216r_18943142
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TTAAATACTGTTGTTTTCAATAAATATTTTATACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTGGCTCTGGAATTTCCTATATAATCTCAAAAAGAACTATGCCCCTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 19043142 19072887 10 99.3 Perfect prediction

ContigView(URL based/DAS) 7 f 53223218 53902067 3 97.2 Perfect prediction

Features of the protein sequence	Description

Length: 670 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH65935	100.0	FAM29A protein ...	Homo sapiens
Q7Z4H7	100.0	Protein FAM29A.	Homo sapiens
AAQ09022	100.0	unknown protein...	Homo sapiens
AAI11042	99.9	FAM29A protein ...	Homo sapiens
CAL38345	99.9	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCAAACACCCGAAAGACAC

Primer_r
: GATGGACGTGCGTAAAGATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: RH-map
Primer_f	: TCCCAAACACCCGAAAGACAC
Primer_r	: GATGGACGTGCGTAAAGATGG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3199 bp
Genome contig ID	gi89161216r_18943142
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TTAAATACTGTTGTTTTCAATAAATATTTTATACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGGCTCTGGAATTTCCTATATAATCTCAAAAAGAACTATGCCCCTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	19043142	19072887	10	99.3	Perfect prediction
ContigView(URL based/DAS)	7	f	53223218	53902067	3	97.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1574

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information