HUGE

Gene/Protein Characteristic Table for KIAA1571

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07410
Accession No. :	AB046791
Description :	zinc finger, DBF-type containing 2.
HUGO Gene Name :	zinc finger, DBF-type containing 2 (ZDBF2)
Clone Name :	fh22968s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh22968, former representative clones for KIAA1571 with fh22968s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 8172 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2831 bp

Genome contig ID gi89161199f_206779222
PolyA signal sequence
(ATTAAA,-11)
+----*----+----*----+----*----+----
TTTGATGTTATCAAGATAAAATTTATTAAACCTTG
Flanking genome sequence
(108173 - 108222)
----+----*----+----*----+----*----+----*----+----*
AAATTTGTCTGTTCTCTCTTCATGTTAGAAACTTTTTCTGGGAATACTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 206879222 206887393 1 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1779 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCK1	100.0	DBF4-type zinc ...	Homo sapiens
XP_001097564	85.1	hypothetical pr...	Macaca mulatta
EAW70385	100.0	hCG2012502 [Hom...	Homo sapiens
BAC85454	100.0	unnamed protein...	Homo sapiens
XP_001787346	52.4	similar to zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGACACTGCACCAACTCAAG

Primer_r
: CTATGGCTGATTTTCGCTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: AGGACACTGCACCAACTCAAG
Primer_r	: CTATGGCTGATTTTCGCTGTC
PCR product length	: 181 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2831 bp
Genome contig ID	gi89161199f_206779222
PolyA signal sequence (ATTAAA,-11)	+--------+--------+----*----+---- TTTGATGTTATCAAGATAAAATTTATTAAACCTTG
Flanking genome sequence (108173 - 108222)	----+--------+--------+--------+--------+----* AAATTTGTCTGTTCTCTCTTCATGTTAGAAACTTTTTCTGGGAATACTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	206879222	206887393	1	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1571

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information