HUGE

Gene/Protein Characteristic Table for KIAA1528

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040961
Description :	Protein deltex-2.
HUGO Gene Name :
Clone Name :	hh03104 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6128 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 387 bp

Genome contig ID gi89161213f_75828986
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ACCTCAATTTTGTTTGCAATAAATGCTCTATAGCC
Flanking genome sequence
(144257 - 144306)
----+----*----+----*----+----*----+----*----+----*
AAAGCCAGCAGGTCCTGAGTGTGTGCATGCATGCGTGTGTGCGCACTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 75928986 75973241 11 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 740 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH08856	0	99.8	DTX2 protein [H...	Homo sapiens
BAB14727	0	99.8	unnamed protein...	Homo sapiens
Q86UW9	0	99.7	Protein deltex-...	Homo sapiens
XP_536849	2.5e-201	90.9	similar to delt...	Canis lupus fam...
XP_001157724	3e-196	95.7	deltex 2, parti...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023154	4.6e-35	45.8	KIAA0937

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004170 127 215 PF02825 WWE

IPR004170 216 292 PF02825 WWE

IPR001841 530 590 PF00097 Zinc finger

HMMSmart IPR004170 135 223 SM00678 WWE

IPR004170 225 300 SM00678 WWE

IPR001841 530 590 SM00184 Zinc finger

ProfileScan IPR004170 126 215 PS50918 WWE

IPR004170 216 292 PS50918 WWE

IPR001841 530 591 PS50089 Zinc finger

ScanRegExp IPR001304 55 81 PS00615 C-type lectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	127	215	PF02825	WWE
IPR004170	216	292	PF02825	WWE
IPR001841	530	590	PF00097	Zinc finger
HMMSmart	IPR004170	135	223	SM00678	WWE
IPR004170	225	300	SM00678	WWE
IPR001841	530	590	SM00184	Zinc finger
ProfileScan	IPR004170	126	215	PS50918	WWE
IPR004170	216	292	PS50918	WWE
IPR001841	530	591	PS50089	Zinc finger
ScanRegExp	IPR001304	55	81	PS00615	C-type lectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCTGGGAGGTTTGTTGAGG

Primer_r
: ATCCTAAGCCCCCATGAGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGCTGGGAGGTTTGTTGAGG
Primer_r	: ATCCTAAGCCCCCATGAGTAC
PCR product length	: 132 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	387 bp
Genome contig ID	gi89161213f_75828986
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ACCTCAATTTTGTTTGCAATAAATGCTCTATAGCC
Flanking genome sequence (144257 - 144306)	----+--------+--------+--------+--------+----* AAAGCCAGCAGGTCCTGAGTGTGTGCATGCATGCGTGTGTGCGCACTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	75928986	75973241	11	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1528

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information