HUGE

Gene/Protein Characteristic Table for KIAA1502

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04526
Accession No. :	AB040935
Description :	cerebral endothelial cell adhesion molecule 1.
HUGO Gene Name :
Clone Name :	hk02042 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4594 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161216f_130113866
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGACATCCTCTCCATGGGATGATGACAGCGGCCGC
Flanking genome sequence
(124036 - 124085)
----+----*----+----*----+----*----+----*----+----*
CTCATCAGCTGGAGCGGCTCCCAAAAGACCCTGCGCAGCCCCCGCCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 130213866 130237900 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 560 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87790	100.0	cerebral endoth...	Homo sapiens
EAW87788	100.0	cerebral endoth...	Homo sapiens
Q5T4B2	100.0	Glycosyltransfe...	Homo sapiens
AAI08699	100.0	CERCAM protein ...	Homo sapiens
XP_001157210	98.8	cerebral endoth...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011156	1.3e-121	54.4	KIAA0584

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002654 318 502 PF01755 Glycosyl transferase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002654	318	502	PF01755	Glycosyl transferase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGGGACCTGATCTACCTTGG

Primer_r
: AACATGATGGGCAGGAACTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161216f_130113866
PolyA signal sequence (None)	+--------+--------+----*----+---- AGACATCCTCTCCATGGGATGATGACAGCGGCCGC
Flanking genome sequence (124036 - 124085)	----+--------+--------+--------+--------+----* CTCATCAGCTGGAGCGGCTCCCAAAAGACCCTGCGCAGCCCCCGCCTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	130213866	130237900	13	99.3	Perfect prediction

Primer_f	: TTGGGACCTGATCTACCTTGG
Primer_r	: AACATGATGGGCAGGAACTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1502

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information