HUGE |
Gene/Protein Characteristic Table for KIAA1358 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05655 |
---|---|
Accession No. : | AB037779 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fj02029 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4183 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 809 bp Genome contig ID gi89161213r_97584112 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTGCACTCCAGCCTGGGCGACAGAGACTCCATCTCFlanking genome sequence
(99715 - 99666) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTGAAGGAAGGAGACAGCAGATTGGAAATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 97683827 97713270 24 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1123 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 781 | 874 | PD718531 | NULL |
HMMPfam | IPR006624 | 167 | 198 | PF06462 | Beta-propeller repeat TECPR |
IPR006624 | 212 | 243 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 259 | 290 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 302 | 334 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 687 | 714 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 911 | 942 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 956 | 987 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1002 | 1033 | PF06462 | Beta-propeller repeat TECPR | |
IPR006624 | 1045 | 1085 | PF06462 | Beta-propeller repeat TECPR | |
HMMSmart | IPR006613 | 22 | 83 | SM00693 | Dysferlin |
IPR006614 | 95 | 128 | SM00694 | Dysferlin | |
IPR006624 | 150 | 183 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 192 | 228 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 237 | 275 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 284 | 319 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 664 | 703 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 719 | 753 | SM00706 | Beta-propeller repeat TECPR | |
IPR006613 | 774 | 835 | SM00693 | Dysferlin | |
IPR006614 | 846 | 879 | SM00694 | Dysferlin | |
IPR006624 | 893 | 927 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 936 | 972 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 981 | 1018 | SM00706 | Beta-propeller repeat TECPR | |
IPR006624 | 1027 | 1062 | SM00706 | Beta-propeller repeat TECPR |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACAGCATCCTCTTCATCTAC | |
: AGTCATTCATGTCCTGCTCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: GACAGCATCCTCTTCATCTAC | |
: AGTCATTCATGTCCTGCTCGG | |
: 193(600) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |