HUGE

Gene/Protein Characteristic Table for KIAA1329

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06945
Accession No. :	AB037750
Description :	VPS10 domain-containing receptor SorCS2 precursor.
HUGO Gene Name :	sortilin-related VPS10 domain containing receptor 2 (SORCS2)
Clone Name :	fh14788 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5287 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2563 bp

Genome contig ID gi89161207f_7591063
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATGCTTTTAACAAAGATTAAATGAATTTGATCAGC
Flanking genome sequence
(204393 - 204442)
----+----*----+----*----+----*----+----*----+----*
TTTTGCCTTATTGTGAAGATACTTTCCTCCTTTCCTGAAATGCATGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 7691063 7795454 24 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PQ0	100.0	VPS10 domain-co...	Homo sapiens
AAI56054	99.9	Sortilin-relate...	synthetic construct
EAW82363	99.9	sortilin-relate...	Homo sapiens
BAG58506	98.4	unnamed protein...	Homo sapiens
XP_545903	90.5	similar to VPS1...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028982	1.4e-160	45.0	KIAA1059

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002860 21 32 PF02012 Glycoside hydrolase

IPR002860 216 227 PF02012 Glycoside hydrolase

IPR002860 293 304 PF02012 Glycoside hydrolase

IPR002860 335 346 PF02012 Glycoside hydrolase

IPR000601 535 617 PF00801 PKD

HMMSmart IPR006581 1 528 SM00602 VPS10

IPR000601 530 620 SM00089 PKD

ProfileScan IPR000601 564 624 PS50093 PKD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002860	21	32	PF02012	Glycoside hydrolase
IPR002860	216	227	PF02012	Glycoside hydrolase
IPR002860	293	304	PF02012	Glycoside hydrolase
IPR002860	335	346	PF02012	Glycoside hydrolase
IPR000601	535	617	PF00801	PKD
HMMSmart	IPR006581	1	528	SM00602	VPS10
IPR000601	530	620	SM00089	PKD
ProfileScan	IPR000601	564	624	PS50093	PKD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 827 GYWAVVVLFVIGLFAAGAFILYK 849 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	827	GYWAVVVLFVIGLFAAGAFILYK	849	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAAGGCAACATCAGCAAACC

Primer_r
: AGGTTGTAGGTGTCCATCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2563 bp
Genome contig ID	gi89161207f_7591063
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATGCTTTTAACAAAGATTAAATGAATTTGATCAGC
Flanking genome sequence (204393 - 204442)	----+--------+--------+--------+--------+----* TTTTGCCTTATTGTGAAGATACTTTCCTCCTTTCCTGAAATGCATGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	7691063	7795454	24	99.4	Perfect prediction

Primer_f	: TTAAGGCAACATCAGCAAACC
Primer_r	: AGGTTGTAGGTGTCCATCTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1329

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information