HUGE

Gene/Protein Characteristic Table for KIAA1210

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05643
Accession No. :	AB033036
Description :
HUGO Gene Name :
Clone Name :	fg06085 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6041 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2692 bp

Genome contig ID gi89161218r_117996627
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
AGATATATGCAAAGCAAATAAATTCAATAAAGCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCTGTAGTCCATCTCTGTCTGTGACATGGGGCGGGAAATCAAATAGGA

Features of the protein sequence	Description

Length: 1115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_065772	0	100.0	hypothetical pr...	Homo sapiens
EAW89884	0	99.9	hCG22014 [Homo ...	Homo sapiens
XP_001100266	0	91.4	hypothetical pr...	Macaca mulatta
XP_608987	1.7e-97	42.0	similar to fibr...	Bos taurus
XP_001492013	1.8e-82	54.3	similar to CG60...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGGCACCTTTACCCCCAGAG

Primer_r
: GGATGGAATGAAGAGAAAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGGCACCTTTACCCCCAGAG
Primer_r	: GGATGGAATGAAGAGAAAGAC
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2692 bp
Genome contig ID	gi89161218r_117996627
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- AGATATATGCAAAGCAAATAAATTCAATAAAGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTGTAGTCCATCTCTGTCTGTGACATGGGGCGGGAAATCAAATAGGA

Gene/Protein Characteristic Table for KIAA1210

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information