HUGE

Gene/Protein Characteristic Table for KIAA1208

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05322
Accession No. :	AB033034
Description :	N-acetylglucosamine-1-phosphotransferase subunits alpha/beta precursor (EC 2.7.8.17) (GlcNAc-1-phosphotransferase alpha/beta subunits) (UDP- N-acetylglucosamine-1-phosphotransferase alpha/beta subunits) (Stealth protein GNPTAB) [Contains: N-acetylglucosam.
HUGO Gene Name :	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits (GNPTAB)
Clone Name :	fj07955 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg05318, former representative clones for KIAA1208 with fj07955. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4511 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1657 bp

Genome contig ID gi89161190r_100563415
PolyA signal sequence
(CATAAA,-18)
+----*----+----*----+----*----+----
TTCAAAAACTGAAATCTCATAAAAAGTTAAATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGTCTGACACTTTGATTTTTAAATCTTTGAGGATTGAGTTTACTGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 100663415 100688500 13 99.5 Terminal No-hit

Features of the protein sequence	Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3T906	100.0	N-acetylglucosa...	Homo sapiens
AAV98624	99.8	GlcNAc-phosphot...	Homo sapiens
XP_001155334	99.5	N-acetylglucosa...	Pan troglodytes
EAW97684	98.8	N-acetylglucosa...	Homo sapiens
XP_001092998	97.6	similar to N-ac...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000800 127 163 PF00066 Notch region

IPR010506 393 508 PF06464 DMAP1-binding

HMMSmart IPR000800 125 163 SM00004 Notch region

IPR000800 192 230 SM00004 Notch region

ProfileScan IPR000800 132 167 PS50258 Notch region

IPR000800 199 239 PS50258 Notch region

IPR002048 699 734 PS50222 Calcium-binding EF-hand

ScanRegExp IPR002048 712 724 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000800	127	163	PF00066	Notch region
IPR010506	393	508	PF06464	DMAP1-binding
HMMSmart	IPR000800	125	163	SM00004	Notch region
IPR000800	192	230	SM00004	Notch region
ProfileScan	IPR000800	132	167	PS50258	Notch region
IPR000800	199	239	PS50258	Notch region
IPR002048	699	734	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	712	724	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGGCGTTACTGAAGTGTTAC

Primer_r
: TTGCTATCAGTGAAGTATGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1657 bp
Genome contig ID	gi89161190r_100563415
PolyA signal sequence (CATAAA,-18)	+--------+--------+----*----+---- TTCAAAAACTGAAATCTCATAAAAAGTTAAATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTCTGACACTTTGATTTTTAAATCTTTGAGGATTGAGTTTACTGTTACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	100663415	100688500	13	99.5	Terminal No-hit

Primer_f	: TAGGCGTTACTGAAGTGTTAC
Primer_r	: TTGCTATCAGTGAAGTATGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1208

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information