HUGE

Gene/Protein Characteristic Table for KIAA1199

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05642
Accession No. :	AB033025
Description :
HUGO Gene Name :
Clone Name :	fg01973 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5776 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2734 bp

Genome contig ID gi51511731f_78868947
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CACTGTCAGAGAAATAAAGAATTGTCTTAAATGTC
Flanking genome sequence
(162109 - 162158)
----+----*----+----*----+----*----+----*----+----*
ATGATTGGAGATGTCCTTTGCATTGCTTGGAAGGGGTGTACCTAGAGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 78968947 79031054 21 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM08762	0	94.9	rCG24762 [Rattu...	Rattus norvegicus
BAC29586	0	94.8	unnamed protein...	Mus musculus
XP_001141007	5.6e-194	48.6	transmembrane p...	Pan troglodytes
EAW62519	5.8e-194	48.8	transmembrane p...	Homo sapiens
Q9UHN6	6.5e-194	48.8	Transmembrane p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037833	3.6e-198	48.8	KIAA1412

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAAACCATTCACCAAGAGCC

Primer_r
: GACAAGCATTTCAGAGGAGCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAAACCATTCACCAAGAGCC
Primer_r	: GACAAGCATTTCAGAGGAGCG
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2734 bp
Genome contig ID	gi51511731f_78868947
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CACTGTCAGAGAAATAAAGAATTGTCTTAAATGTC
Flanking genome sequence (162109 - 162158)	----+--------+--------+--------+--------+----* ATGATTGGAGATGTCCTTTGCATTGCTTGGAAGGGGTGTACCTAGAGCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	78968947	79031054	21	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1199

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information