HUGE

Gene/Protein Characteristic Table for KIAA1178

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04495
Accession No. :	AB033004
Description :	CD2 antigen cytoplasmic tail-binding protein 2.
HUGO Gene Name :
Clone Name :	hh01688a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2592 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 124 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ13502	2.1e-53	100.0	FWP010 [Homo sa...	Homo sapiens
O95400	3.4e-53	100.0	CD2 antigen cyt...	Homo sapiens
XP_001110388	1.6e-51	96.8	CD2 antigen (cy...	Macaca mulatta
CAH91235	3.1e-51	97.6	hypothetical pr...	Pongo abelii
CAH91742	3.1e-51	97.6	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003169 64 121 PF02213 GYF

HMMSmart IPR003169 64 121 SM00444 GYF

ProfileScan IPR003169 63 121 PS50829 GYF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003169	64	121	PF02213	GYF
HMMSmart	IPR003169	64	121	SM00444	GYF
ProfileScan	IPR003169	63	121	PS50829	GYF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCATCGAGAAGACATTGGGAC

Primer_r
: AGATTAGGGAAGACACTGGCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCATCGAGAAGACATTGGGAC
Primer_r	: AGATTAGGGAAGACACTGGCT
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Gene/Protein Characteristic Table for KIAA1178

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information