HUGE

Gene/Protein Characteristic Table for KIAA1136

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05344
Accession No. :	AB032962
Description :	Probable G-protein coupled receptor 158 precursor.
HUGO Gene Name :	G protein-coupled receptor 158 (GPR158)
Clone Name :	hj01467 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj02663, former representative clones for KIAA1136 with hj01467. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4789 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2952 bp

Genome contig ID gi89161187f_25823148
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATTATAACTTCTCTGCAATAAAACATATTTATATG
Flanking genome sequence
(108015 - 108064)
----+----*----+----*----+----*----+----*----+----*
AAAGTGATTTGTGGGGATTTGTGTGTTCATCTATAGAAAACTGAATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 25923144 25931161 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 596 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T848	1.9e-212	98.7	Probable G-prot...	Homo sapiens
AAS18315	4.2e-212	98.5	G protein coupl...	Homo sapiens
XP_521427	5.5e-212	98.3	hypothetical pr...	Pan troglodytes
XP_001101165	1.5e-202	94.4	G protein-coupl...	Macaca mulatta
EAW86110	1.7e-190	100.0	hCG24620 [Homo ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATCACTCAGAAATAGAACCG

Primer_r
: TAAGAACAGCCCTATATCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2952 bp
Genome contig ID	gi89161187f_25823148
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATTATAACTTCTCTGCAATAAAACATATTTATATG
Flanking genome sequence (108015 - 108064)	----+--------+--------+--------+--------+----* AAAGTGATTTGTGGGGATTTGTGTGTTCATCTATAGAAAACTGAATTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	25923144	25931161	3	99.0	Perfect prediction

Primer_f	: AATCACTCAGAAATAGAACCG
Primer_r	: TAAGAACAGCCCTATATCCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1136

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information