HUGE

Gene/Protein Characteristic Table for KIAA1096

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04253
Accession No. :	AB029019
Description :	HBxAg transactivated protein 2.
HUGO Gene Name :	BAT2 domain containing 1 (BAT2D1)
Clone Name :	pf00402 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced hk06861, former representative clones for KIAA1096 with pf00402. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7421 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1659 bp

Genome contig ID gi89161185f_169676024
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGATTACAGAAACTAATAAAGTATTCTCTAAAT
Flanking genome sequence
(153246 - 153295)
----+----*----+----*----+----*----+----*----+----*
AATGATTCTTGGAGCTTATAATCATTTCCTAAAATCTGAAGCAAGAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 169776024 169829268 21 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001145208	99.5	HBxAg transacti...	Pan troglodytes
XP_001099397	98.1	similar to HBxA...	Macaca mulatta
XP_862019	90.3	similar to HBxA...	Canis lupus fam...
XP_537196	90.3	similar to HBxA...	Canis lupus fam...
Q9Y520	97.5	BAT2 domain-con...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011087	2.8e-05	31.0	KIAA0515
AB002322	0.00014	21.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTGTTGAGTTGGCATTGTAC

Primer_r
: CAAACCCATGTAGATAAGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1659 bp
Genome contig ID	gi89161185f_169676024
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGATTACAGAAACTAATAAAGTATTCTCTAAAT
Flanking genome sequence (153246 - 153295)	----+--------+--------+--------+--------+----* AATGATTCTTGGAGCTTATAATCATTTCCTAAAATCTGAAGCAAGAGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	169776024	169829268	21	99.3	Perfect prediction

Primer_f	: TGTGTTGAGTTGGCATTGTAC
Primer_r	: CAAACCCATGTAGATAAGACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1096

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information