| HUGE |
Gene/Protein Characteristic Table for KIAA1086 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05633 |
|---|---|
| Accession No. : | AB029009 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | hj08218 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4635 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1925 bp Genome contig ID gi42406306r_3655022 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTGGGAGGCAGGGGGAATAAAGGAAATCATTTGTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TTTTGTGTGAGCCGTGCCGTCCTTCCTGCGGGGTGCAGGTGACCCCAAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 3755022 3785924 18 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 902 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CAACCTGTTCAAACCTTCCGC | |
| : TTCAGACAGAGCCACATGCAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 19 |
| : GeneBridge 4 | |
| : CAACCTGTTCAAACCTTCCGC | |
| : TTCAGACAGAGCCACATGCAG | |
| : 164 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |