HUGE

Gene/Protein Characteristic Table for KIAA0856

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04796
Accession No. :	AB020663
Description :	Protein DmX-like 2.
HUGO Gene Name :	Dmx-like 2 (DMXL2)
Clone Name :	bf00171 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk06221, former representative clones for KIAA0856 with bf00171. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7912 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1196 bp

Genome contig ID gi51511731r_49427277
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ATGTAAAAGAAAAATAAATGTTATTTGTTAGAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTAGTTTGATACTGTTTTTGACCATTGAGATTTTTAATTTGATAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 49527277 49615189 31 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2237 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44540	100.0	DMXL2 protein [...	Homo sapiens
EAW77422	99.9	Dmx-like 2, iso...	Homo sapiens
Q8TDJ6	99.8	DmX-like protei...	Homo sapiens
XP_510406	99.7	Dmx-like 2 [Pan...	Pan troglodytes
XP_535481	95.9	similar to Dmx-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020700	0.00063	23.7	KIAA0893

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 202 228 PF00400 WD40 repeat

IPR001680 2091 2129 PF00400 WD40 repeat

IPR001680 2133 2171 PF00400 WD40 repeat

HMMSmart IPR001680 187 228 SM00320 WD40 repeat

IPR001680 435 472 SM00320 WD40 repeat

IPR001680 1957 1992 SM00320 WD40 repeat

IPR001680 1996 2035 SM00320 WD40 repeat

IPR001680 2042 2084 SM00320 WD40 repeat

IPR001680 2090 2129 SM00320 WD40 repeat

IPR001680 2132 2171 SM00320 WD40 repeat

IPR001680 2184 2222 SM00320 WD40 repeat

ProfileScan IPR001680 1960 2180 PS50294 WD40 repeat

IPR001680 2097 2138 PS50082 WD40 repeat

IPR001680 2139 2180 PS50082 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	202	228	PF00400	WD40 repeat
IPR001680	2091	2129	PF00400	WD40 repeat
IPR001680	2133	2171	PF00400	WD40 repeat
HMMSmart	IPR001680	187	228	SM00320	WD40 repeat
IPR001680	435	472	SM00320	WD40 repeat
IPR001680	1957	1992	SM00320	WD40 repeat
IPR001680	1996	2035	SM00320	WD40 repeat
IPR001680	2042	2084	SM00320	WD40 repeat
IPR001680	2090	2129	SM00320	WD40 repeat
IPR001680	2132	2171	SM00320	WD40 repeat
IPR001680	2184	2222	SM00320	WD40 repeat
ProfileScan	IPR001680	1960	2180	PS50294	WD40 repeat
IPR001680	2097	2138	PS50082	WD40 repeat
IPR001680	2139	2180	PS50082	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1542 NILLCEAVVAVYLSLLIHALATN 1564 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1542	NILLCEAVVAVYLSLLIHALATN	1564	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGCCAGTTAATAGTTGATGAG

Primer_r
: CCACACAGGCATTGAACATTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1196 bp
Genome contig ID	gi51511731r_49427277
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATGTAAAAGAAAAATAAATGTTATTTGTTAGAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTAGTTTGATACTGTTTTTGACCATTGAGATTTTTAATTTGATAAAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	49527277	49615189	31	99.7	Perfect prediction

Primer_f	: GGCCAGTTAATAGTTGATGAG
Primer_r	: CCACACAGGCATTGAACATTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0856

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information