HUGE

Gene/Protein Characteristic Table for KIAA0824

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06290
Accession No. :	AB020631
Description :	Pre-mRNA cleavage complex 2 protein Pcf11 (Fragment).
HUGO Gene Name :	PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) (PCF11)
Clone Name :	hh02773 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5834 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 897 bp

Genome contig ID gi51511727f_82445861
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAATATTCATACATGTAATAAATAGAATGATGAAG
Flanking genome sequence
(128622 - 128671)
----+----*----+----*----+----*----+----*----+----*
AAACTTTGTTTGTACTTCTTTATTTCTTGAAAAGCTTTAGAATGTGACTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 82545861 82574481 16 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94913	100.0	Pre-mRNA cleava...	Homo sapiens
EAW75084	99.9	PCF11, cleavage...	Homo sapiens
XP_508673	94.3	pre-mRNA cleava...	Pan troglodytes
EDL06725	93.3	cleavage and po...	Mus musculus
NP_083354	93.3	pre-mRNA cleava...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058773	2.1e-09	33.2	KIAA1870
AB011108	0.0008	25.2	KIAA0536

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR006569 106 228 SM00582 Regulation of nuclear pre-mRNA protein

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006569	106	228	SM00582	Regulation of nuclear pre-mRNA protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCAAAAGGGGGTTCCGAGAG

Primer_r
: ATACCTGGAGATGTGTTTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCAAAAGGGGGTTCCGAGAG
Primer_r	: ATACCTGGAGATGTGTTTGTG
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec62 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	897 bp
Genome contig ID	gi51511727f_82445861
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAATATTCATACATGTAATAAATAGAATGATGAAG
Flanking genome sequence (128622 - 128671)	----+--------+--------+--------+--------+----* AAACTTTGTTTGTACTTCTTTATTTCTTGAAAAGCTTTAGAATGTGACTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	82545861	82574481	16	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0824

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information