HUGE

Gene/Protein Characteristic Table for KIAA0749

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04724
Accession No. :	AB018292
Description :	Dendrin.
HUGO Gene Name :	dendrin (DDN)
Clone Name :	hk04328 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3628 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1590 bp

Genome contig ID gi89161190r_47575397
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CACAGTAGGCGCTCAATAAATCTAAGCTTCCCTTT
Flanking genome sequence
(99803 - 99754)
----+----*----+----*----+----*----+----*----+----*
ATCCAGCCTTGGCATCGTCTTCCTTTCACTGACCCTTTCCCCACAGTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 47675200 47679239 2 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW58031	3.1e-210	100.0	dendrin [Homo s...	Homo sapiens
O94850	9.7e-204	100.0	Dendrin.	Homo sapiens
XP_001105260	2e-200	96.0	dendrin [Macaca...	Macaca mulatta
XP_851155	1.5e-159	77.9	similar to Dend...	Canis lupus fam...
XP_001491757	4.7e-155	81.2	similar to Dend...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTCCATCCTTCCGTCTCTGA

Primer_r
: TGACTTTGGGTGACACGGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGATAGCGGCCCTGTCACTG
Primer_r	: ACGCCTCAGAGCATCACTAAG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1590 bp
Genome contig ID	gi89161190r_47575397
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CACAGTAGGCGCTCAATAAATCTAAGCTTCCCTTT
Flanking genome sequence (99803 - 99754)	----+--------+--------+--------+--------+----* ATCCAGCCTTGGCATCGTCTTCCTTTCACTGACCCTTTCCCCACAGTGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	47675200	47679239	2	100.0	Perfect prediction

Primer_f	: GGTCCATCCTTCCGTCTCTGA
Primer_r	: TGACTTTGGGTGACACGGAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0749

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information