HUGE

Gene/Protein Characteristic Table for KIAA0711

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05564
Accession No. :	AB018254
Description :	Kelch repeat and BTB domain-containing protein 11.
HUGO Gene Name :	kelch repeat and BTB (POZ) domain containing 11 (KBTBD11)
Clone Name :	hg00358 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6706 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3871 bp

Genome contig ID gi51511724f_1809451
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CCGAGATGAAATAAATCACGCAGAAAGTGCCAGTC
Flanking genome sequence
(133060 - 133109)
----+----*----+----*----+----*----+----*----+----*
CTCCTGATGTGCCCCGAGTGCTTTTCTCTTTCTCCACAGCGAGCGTCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 1909451 1942509 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 661 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94819	9.8e-212	100.0	Kelch repeat an...	Homo sapiens
Q8BNW9	8.9e-165	80.5	Kelch repeat an...	Mus musculus
AAH80858	1.4e-164	80.3	Kbtbd11 protein...	Mus musculus
BAC37803	2.3e-164	80.2	unnamed protein...	Mus musculus
XP_001381495	9.7e-114	57.8	hypothetical pr...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037761	1.1e-09	29.9	KIAA1340
AB037775	4.9e-07	29.1	KIAA1354
AB037730	1.9e-06	28.1	KIAA1309
D50922	1.2e-05	31.7	KIAA0132
AB067487	3.4e-05	24.2	KIAA1900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 171 269 PF00651 BTB/POZ

IPR006652 386 437 PF01344 Kelch repeat type 1

IPR006652 439 480 PF01344 Kelch repeat type 1

IPR006652 484 525 PF01344 Kelch repeat type 1

HMMSmart IPR000210 178 269 SM00225 BTB/POZ-like

IPR006652 398 450 SM00612 Kelch repeat type 1

IPR006652 451 495 SM00612 Kelch repeat type 1

IPR006652 496 538 SM00612 Kelch repeat type 1

ProfileScan IPR000210 178 234 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	171	269	PF00651	BTB/POZ
IPR006652	386	437	PF01344	Kelch repeat type 1
IPR006652	439	480	PF01344	Kelch repeat type 1
IPR006652	484	525	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	178	269	SM00225	BTB/POZ-like
IPR006652	398	450	SM00612	Kelch repeat type 1
IPR006652	451	495	SM00612	Kelch repeat type 1
IPR006652	496	538	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	178	234	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCTCCAAAGCCTGTTCAAGC

Primer_r
: GAACTGACAAACATACGAGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCTCCAAAGCCTGTTCAAGC
Primer_r	: GAACTGACAAACATACGAGGC
PCR product length	: 185 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3871 bp
Genome contig ID	gi51511724f_1809451
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CCGAGATGAAATAAATCACGCAGAAAGTGCCAGTC
Flanking genome sequence (133060 - 133109)	----+--------+--------+--------+--------+----* CTCCTGATGTGCCCCGAGTGCTTTTCTCTTTCTCCACAGCGAGCGTCAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	1909451	1942509	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0711

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information