| HUGE |
Gene/Protein Characteristic Table for KIAA0698 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05414 |
|---|---|
| Accession No. : | AB014598 |
| Description : | Hephaestin precursor. |
| HUGO Gene Name : | hephaestin (HEPH) |
| Clone Name : | hg00360s1 [Vector Info] |
| Source : | Human adult brain |
| Note : | We replaced hg00360, former representative clones for KIAA0698 with hg00360s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4228 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 714 bp Genome contig ID gi89161218f_65200834 PolyA signal sequence
(ATTAAA,-24)
AAACCCTATCCATTAAAGTACTTGTTAGAACACTGFlanking genome sequence
(203121 - 203170)
AAAGACTGAATTTGGTGATTTTTGACAGTCTCTGTGGCTTCTGTCACTGT
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1104 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : CTCAACATTCCTTTCAGTGCC | |
| : TGAAGGTAGGCTGAGTATTGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : X |
| : GeneBridge 4 | |
| : CTCAACATTCCTTTCAGTGCC | |
| : TGAAGGTAGGCTGAGTATTGG | |
| : 183 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
