HUGE

Gene/Protein Characteristic Table for KIAA0684

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07268
Accession No. :	AB014584
Description :	Ubiquitin conjugation factor E4 B.
HUGO Gene Name :	ubiquitination factor E4B (UFD2 homolog, yeast) (UBE4B)
Clone Name :	hk07567 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk02956, former representative clones for KIAA0684 with hk07567. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 4161 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 60 bp

Genome contig ID gi89161185f_9915737
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGACACAGCCAAGGCCAACGAGGCAAGCAGAAGCA
Flanking genome sequence
(246926 - 246975)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCAGCGAAGCTGCCGTTCATGTGTTGGAGGCCAAATGTGGCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 10015737 10162661 27 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK69622	100.0	ubiquitin-fusio...	Homo sapiens
BAF85133	99.9	unnamed protein...	Homo sapiens
XP_001161612	99.8	ubiquitination ...	Pan troglodytes
XP_001101932	99.7	ubiquitination ...	Macaca mulatta
XP_001915350	98.6	ubiquitination ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50916	4.6e-24	27.3	KIAA0126

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003613 1143 1216 PF04564 U box

HMMSmart IPR003613 1147 1209 SM00504 U box

ScanRegExp IPR006162 307 322 PS00012 Phosphopantetheine attachment site

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003613	1143	1216	PF04564	U box
HMMSmart	IPR003613	1147	1209	SM00504	U box
ScanRegExp	IPR006162	307	322	PS00012	Phosphopantetheine attachment site

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGACGACCAGAGATCCTACAG

Primer_r
: TGTAGTCGATTTCTGCGCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCATCATCCTGCGGCACCTG
Primer_r	: CATCCACGCCTGAATCTGCTC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	60 bp
Genome contig ID	gi89161185f_9915737
PolyA signal sequence (None)	+--------+--------+----*----+---- AGACACAGCCAAGGCCAACGAGGCAAGCAGAAGCA
Flanking genome sequence (246926 - 246975)	----+--------+--------+--------+--------+----* GCGGCCGCAGCGAAGCTGCCGTTCATGTGTTGGAGGCCAAATGTGGCAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	10015737	10162661	27	100.0	Perfect prediction

Primer_f	: TGACGACCAGAGATCCTACAG
Primer_r	: TGTAGTCGATTTCTGCGCGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0684

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information