HUGE

Gene/Protein Characteristic Table for KIAA0641

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04004
Accession No. :	AB014541
Description :	Serine/threonine-protein kinase LMTK1.
HUGO Gene Name :	apoptosis-associated tyrosine kinase (AATK)
Clone Name :	hj03494s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj03494, former representative clones for KIAA0641 with hj03494s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1104 bp

Genome contig ID gi51511734r_76605693
PolyA signal sequence
(AAGAAA,-10)
+----*----+----*----+----*----+----
CTTGTTTTTTAAGAGAAATGAAGCTAAGAAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACCTTTGTGTGTTGTCTTCTGAGGTCTGCCGATGATAAAGTCCTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 76705693 76720343 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1326 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZMQ8	0	99.8	Serine/threonin...	Homo sapiens
XP_001111343	0	92.5	similar to apop...	Macaca mulatta
XP_001720798	0	99.9	similar to Seri...	Homo sapiens
EDM06810	1.1e-214	72.3	rCG32884, isofo...	Rattus norvegicus
XP_001075880	1.1e-214	72.3	similar to apop...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067470	4.4e-33	35.5	KIAA1883
AB029002	1.3e-25	34.2	KIAA1079

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 80 345 PD000001 Protein kinase

FPrintScan IPR001245 154 167 PR00109 Tyrosine protein kinase

IPR001245 195 213 PR00109 Tyrosine protein kinase

IPR001245 270 292 PR00109 Tyrosine protein kinase

HMMPfam IPR001245 77 347 PF07714 Tyrosine protein kinase

HMMSmart IPR001245 77 347 SM00219 Tyrosine protein kinase

IPR002290 77 350 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 77 347 PS50011 Protein kinase

ScanRegExp IPR000719 83 108 PS00107 Protein kinase

IPR008266 201 213 PS00109 Tyrosine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	80	345	PD000001	Protein kinase
FPrintScan	IPR001245	154	167	PR00109	Tyrosine protein kinase
IPR001245	195	213	PR00109	Tyrosine protein kinase
IPR001245	270	292	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	77	347	PF07714	Tyrosine protein kinase
HMMSmart	IPR001245	77	347	SM00219	Tyrosine protein kinase
IPR002290	77	350	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	77	347	PS50011	Protein kinase
ScanRegExp	IPR000719	83	108	PS00107	Protein kinase
IPR008266	201	213	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGACTCAGCTAGACCCGTAAG

Primer_r
: CCCTCCACCCCTGATCTTTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: TGACTCAGCTAGACCCGTAAG
Primer_r	: CCCTCCACCCCTGATCTTTTG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1104 bp
Genome contig ID	gi51511734r_76605693
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- CTTGTTTTTTAAGAGAAATGAAGCTAAGAAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCTTTGTGTGTTGTCTTCTGAGGTCTGCCGATGATAAAGTCCTGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	76705693	76720343	13	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0641

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information