HUGE

Gene/Protein Characteristic Table for KIAA0616

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04637
Accession No. :	AB014516
Description :	CREB-regulated transcription coactivator 1.
HUGO Gene Name :	CREB regulated transcription coactivator 1 (CRTC1)
Clone Name :	hg03623 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6718 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4812 bp

Genome contig ID gi42406306f_18555560
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACTCTGCCACGGACGTCCCGTGGGCCATGATTGT
Flanking genome sequence
(198446 - 198495)
----+----*----+----*----+----*----+----*----+----*
GGGCGGCCGCAGCGGGCGGGGGCAGGCGGCTCAGGGCACACTCGGCCGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 18655560 18754004 15 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 634 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAQ98856	9.2e-152	100.0	transducer of r...	Homo sapiens
XP_001115541	3.5e-145	99.5	mucoepidermoid ...	Macaca mulatta
XP_871861	1.1e-142	93.9	mucoepidermoid ...	Bos taurus
XP_001915289	9.7e-138	93.8	similar to muco...	Equus caballus
Q6UUV9	8.6e-133	97.5	CREB-regulated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGTGCTGGCTCTGATGATTC

Primer_r
: AAGTTCTTGATGGCTGGGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGTGCTGGCTCTGATGATTC
Primer_r	: AAGTTCTTGATGGCTGGGCTG
PCR product length	: 174 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4812 bp
Genome contig ID	gi42406306f_18555560
PolyA signal sequence (None)	+--------+--------+----*----+---- TACTCTGCCACGGACGTCCCGTGGGCCATGATTGT
Flanking genome sequence (198446 - 198495)	----+--------+--------+--------+--------+----* GGGCGGCCGCAGCGGGCGGGGGCAGGCGGCTCAGGGCACACTCGGCCGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	18655560	18754004	15	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0616

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information