HUGE

Gene/Protein Characteristic Table for KIAA0570

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05611
Accession No. :	AB011142
Description :	Ubiquitin carboxyl-terminal hydrolase 34.
HUGO Gene Name :	ubiquitin specific peptidase 34 (USP34)
Clone Name :	hk03615s2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh02365, former representative clones for KIAA0570 with hk03615s2. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 11269 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 551 bp

Genome contig ID gi89161199r_61168190
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GAATACCTGTGGAGGAAATAAAGCACACTTGATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATAATTGTTTTATTTTTATTGACATGACTGATTGATTGATTGCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 61268190 61551493 81 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 3412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE51938	100.0	ubiquitin-speci...	Homo sapiens
EAW99998	100.0	ubiquitin speci...	Homo sapiens
Q70CQ2	100.0	Ubiquitin carbo...	Homo sapiens
XP_855134	98.8	similar to ubiq...	Canis lupus fam...
XP_613697	98.6	similar to ubiq...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018272	0	100.0	KIAA0729
AB028980	3.6e-20	26.0	KIAA1057
AB028986	4.6e-05	24.2	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 1757 2102 PF00443 Peptidase C19

ProfileScan IPR001394 1760 2106 PS50235 Peptidase C19

ScanRegExp IPR001394 1761 1776 PS00972 Peptidase C19

IPR001394 2014 2031 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	1757	2102	PF00443	Peptidase C19
ProfileScan	IPR001394	1760	2106	PS50235	Peptidase C19
ScanRegExp	IPR001394	1761	1776	PS00972	Peptidase C19
IPR001394	2014	2031	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTATATTCAGTCAGTCACAGG

Primer_r
: AGATGAGATTTGGGTGGAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTATATTCAGTCAGTCACAGG
Primer_r	: AGATGAGATTTGGGTGGAGAC
PCR product length	: 205 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	551 bp
Genome contig ID	gi89161199r_61168190
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GAATACCTGTGGAGGAAATAAAGCACACTTGATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATAATTGTTTTATTTTTATTGACATGACTGATTGATTGATTGCTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	61268190	61551493	81	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0570

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information