HUGE

Gene/Protein Characteristic Table for KIAA0510

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK06941
Accession No. :	AB007979
Description :
HUGO Gene Name :
Clone Name :	hh00345 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5596 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5306 bp

Genome contig ID gi89161185r_173450956
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CACATTTTCTATACGTTAATAAAAGATCCTGAAAG
Flanking genome sequence
(205415 - 205366)
----+----*----+----*----+----*----+----*----+----*
GCTTTTCAAAAGGGGAAAGGTAGGAAGATCAATGTGAGAAAAAATGTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 173550468 173556370 2 98.9 Terminal No-hit

Features of the protein sequence	Description

Length: 95 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD66575	2.9e-20	90.3	unnamed protein...	Homo sapiens
EAW66413	3e-20	90.3	hypothetical pr...	Homo sapiens
BAB15753	5.2e-20	90.3	FLJ00056 protei...	Homo sapiens
EAW66412	5.7e-20	90.3	hypothetical pr...	Homo sapiens
EAW66411	5.8e-20	90.3	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAACAAGCAGAGATTCCAGTC
Primer_r	: TACTCCTCAGACGATGCACAC
PCR product length	: 132 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5306 bp
Genome contig ID	gi89161185r_173450956
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CACATTTTCTATACGTTAATAAAAGATCCTGAAAG
Flanking genome sequence (205415 - 205366)	----+--------+--------+--------+--------+----* GCTTTTCAAAAGGGGAAAGGTAGGAAGATCAATGTGAGAAAAAATGTTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	173550468	173556370	2	98.9	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0510

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information