| HUGE |
Gene/Protein Characteristic Table for KIAA0485 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK07633 |
|---|---|
| Accession No. : | AB007954 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | hg00837 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6565 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1954 bp Genome contig ID gi89161185f_61262746 PolyA signal sequence
(ACTAAA,-26) +----*----+----*----+----*----+----
TATTTTATCACTAAATGCTTAAGTGTTTATGTTGCFlanking genome sequence
(107159 - 107208) ----+----*----+----*----+----*----+----*----+----*
AAAAAGAAAAGGAAAAAAAAAAGATTCCCACTTGGACTCTCAAACCATGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 61362746 61369903 2 98.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 83 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : GeneBridge 4 | |
| : CTAGAGGCTCCAGATCCAATG | |
| : CATATTAGGGGAAGAGTAGGG | |
| : 125 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |