HUGE

Gene/Protein Characteristic Table for KIAA0442

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04237
Accession No. :	AB007902
Description :	Autism susceptibility gene 2 protein.
HUGO Gene Name :	autism susceptibility candidate 2 (AUTS2)
Clone Name :	hh03913 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh00712, former representative clones for KIAA0442 with hh03913. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5495 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1491 bp

Genome contig ID gi89161213f_68602280
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAGTGCTATCTGACGTTGTTATCCTGTTTTTGC
Flanking genome sequence
(1293131 - 1293180)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGTTAACTACAGACCATTGTTTCTAATAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 68702280 69895409 16 100.0 Internal No-hit

Features of the protein sequence	Description

Length: 1266 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH64693	0	99.9	AUTS2 protein [...	Homo sapiens
EDL19458	7.7e-216	86.7	mCG121910, isof...	Mus musculus
Q8WXX7	7.5e-176	98.0	Autism suscepti...	Homo sapiens
AAS07468	1.6e-175	97.6	unknown [Homo s...	Homo sapiens
XP_001089340	3.9e-175	96.7	similar to auti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046765	2.7e-12	38.6	KIAA1545
AB007927	0.00075	23.9	KIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 659 865 PD360677 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	659	865	PD360677	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAAGAAGAAACCCTAGGCAG

Primer_r
: ATGACTGGGCTAAAAGATCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CATTACACAAGAAGGCTCCGC
Primer_r	: GTTCTATACGGACCTTTTTGC
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec64 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1491 bp
Genome contig ID	gi89161213f_68602280
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAGTGCTATCTGACGTTGTTATCCTGTTTTTGC
Flanking genome sequence (1293131 - 1293180)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTTAACTACAGACCATTGTTTCTAATAAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	68702280	69895409	16	100.0	Internal No-hit

Primer_f	: GGAAGAAGAAACCCTAGGCAG
Primer_r	: ATGACTGGGCTAAAAGATCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0442

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information