| HUGE |
Gene/Protein Characteristic Table for KIAA0421 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06907 |
|---|---|
| Accession No. : | AB007881 |
| Description : | Serine/threonine-protein kinase SMG1. |
| HUGO Gene Name : | |
| Clone Name : | hh01158s1 [Vector Info] |
| Source : | Human adult brain |
| Note : | We replaced hh01158, former representative clones for KIAA0421 with hh01158s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7775 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1808 bp Genome contig ID gi51511732r_18626884 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
GAGCTAGACTCTGTGTCAAAAATAAATGACTAGATFlanking genome sequence
(99699 - 99650) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATTGTTTGAGTACATTTTCCCTGCATTTTAGAGATTAGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 r 18726583 18770922 31 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1988 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : GGGTTTTTATTTTGGATCAGC | |
| : AGTTATTAGTCTGTGAAGTGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : GGGTTTTTATTTTGGATCAGC | |
| : AGTTATTAGTCTGTGAAGTGC | |
| : 111 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |