HUGE

Gene/Protein Characteristic Table for KIAA0415

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05599
Accession No. :	AB007875
Description :
HUGO Gene Name :
Clone Name :	hh00186 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5743 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 634 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE27165	2.9e-195	77.6	unnamed protein...	Mus musculus
XP_590057	2.2e-185	73.0	hypothetical pr...	Bos taurus
XP_001480761	4.2e-183	74.8	hypothetical pr...	Mus musculus
XP_001480764	7.7e-183	74.6	hypothetical pr...	Mus musculus
XP_851709	3.9e-158	77.9	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGTTTCCGAGGTTCGTGCGC

Primer_r
: AACTTCTTCAGCTCCTCGTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTCTCACTGGGCCTTAGCTG
Primer_r	: CATAAAGGTTCTCCAAGTCCC
PCR product length	: 76 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Primer_f	: GAGTTTCCGAGGTTCGTGCGC
Primer_r	: AACTTCTTCAGCTCCTCGTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0415

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information