HUGE

Gene/Protein Characteristic Table for KIAA0395

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07426
Accession No. :	AB007855
Description :	Zinc fingers and homeoboxes protein 3.
HUGO Gene Name :	zinc fingers and homeoboxes 3 (ZHX3)
Clone Name :	fg04028s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hf00285 and fg04028, former representative clones for KIAA0395 with fg04028s1. (2002/5/10,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6297 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3077 bp

Genome contig ID gi51511747r_39144169
PolyA signal sequence
(GATAAA,-21)
+----*----+----*----+----*----+----
CAGATGATCATTCTGATAAAGGAAATTTAAATTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACATATGCTTTGTATATTTTGATTACTTGTTTTCGTTTTTGACTATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 39244169 39331139 3 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001141515	99.3	zinc fingers an...	Pan troglodytes
Q9H4I2	99.9	Zinc fingers an...	Homo sapiens
BAF85104	99.8	unnamed protein...	Homo sapiens
XP_001086350	97.9	similar to zinc...	Macaca mulatta
AAH68569	93.4	ZHX3 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020661	6.2e-16	33.4	KIAA0854
AB037864	1.5e-06	22.8	KIAA1443

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001356 554 597 PD000010 Homeobox

HMMPfam IPR001356 545 598 PF00046 Homeobox

IPR001356 663 713 PF00046 Homeobox

HMMSmart IPR015880 124 147 SM00355 Zinc finger

IPR015880 156 179 SM00355 Zinc finger

IPR001356 351 413 SM00389 Homeobox

IPR001356 541 603 SM00389 Homeobox

IPR001356 660 721 SM00389 Homeobox

IPR001356 811 873 SM00389 Homeobox

ProfileScan IPR001356 366 409 PS50071 Homeobox

IPR001356 549 599 PS50071 Homeobox

IPR001356 669 717 PS50071 Homeobox

IPR001356 819 869 PS50071 Homeobox

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	554	597	PD000010	Homeobox
HMMPfam	IPR001356	545	598	PF00046	Homeobox
IPR001356	663	713	PF00046	Homeobox
HMMSmart	IPR015880	124	147	SM00355	Zinc finger
IPR015880	156	179	SM00355	Zinc finger
IPR001356	351	413	SM00389	Homeobox
IPR001356	541	603	SM00389	Homeobox
IPR001356	660	721	SM00389	Homeobox
IPR001356	811	873	SM00389	Homeobox
ProfileScan	IPR001356	366	409	PS50071	Homeobox
IPR001356	549	599	PS50071	Homeobox
IPR001356	669	717	PS50071	Homeobox
IPR001356	819	869	PS50071	Homeobox

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

Experimental conditions

Panel name	:
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3077 bp
Genome contig ID	gi51511747r_39144169
PolyA signal sequence (GATAAA,-21)	+--------+--------+----*----+---- CAGATGATCATTCTGATAAAGGAAATTTAAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACATATGCTTTGTATATTTTGATTACTTGTTTTCGTTTTTGACTATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	39244169	39331139	3	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0395

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information