Gene/Protein Characteristic Table for KIAA0347

Length: 6218 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	2329 bp
Genome contig ID	gi89161199r_238717425
PolyA signal sequence (AATAAA,-20)	+----*----+----*----+----*----+---- TTTAGAAAATTGGTAAATAAAGCAAGTATATTTTT
Flanking genome sequence (244407 - 244358)	----+----*----+----*----+----*----+----*----+----* GAATGTAGGTCAAGTTGGATCCCTTGAACACACAAGCAAAACAGCCTGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	238791497	238861831	25	99.3	Terminal No-hit

Length: 1281 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source O15055 0 100.0 Period circadia... Homo sapiens XP_001154675 0 99.8 period 2 isofor... Pan troglodytes BAG57975 0 99.8 unnamed protein... Homo sapiens XP_001086845 0 94.2 similar to peri... Macaca mulatta EDL40029 0 77.9 period homolog ... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB088477 1.5e-42 44.3 KIAA0482 AB047686 6e-34 37.6 KIAA1779

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013655	369	456	PF08447	PAS fold-3
HMMSmart	IPR000014	207	274	SM00091	PAS
	IPR000014	347	413	SM00091	PAS
ProfileScan	IPR000014	372	415	PS50112	PAS

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-