HUGE

Gene/Protein Characteristic Table for KIAA0342

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05593
Accession No. :	AB002340
Description :	lupus brain antigen 1.
HUGO Gene Name :
Clone Name :	bf03307 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg03234, former representative clones for KIAA0342 with bf03307. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8859 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1455 bp

Genome contig ID gi89161205r_36743315
PolyA signal sequence
(TATAAA,-23)
+----*----+----*----+----*----+----
TATCACATTTTTTATAAAGTTAAAGCATTTCTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATGCTGCCGTTTTATTTCCAGTCTCTACTCAGAGTAAGGGGGTAAATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 36843315 36875378 13 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 2467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW64479	100.0	hCG2042887, iso...	Homo sapiens
O15050	100.0	Lupus brain ant...	Homo sapiens
NP_055646	100.0	lupus brain ant...	Homo sapiens
XP_236660	83.4	hypothetical pr...	Rattus norvegicus
Q8BV79	83.3	Lupus brain ant...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR002110 5 131 PS50297 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002110	5	131	PS50297	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGCAGCATGAGCAGCAAAAGC

Primer_r
: CCTCTCTGATGGTTACTGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCAGCATGAGCAGCAAAAGC
Primer_r	: CCTCTCTGATGGTTACTGCCC
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1455 bp
Genome contig ID	gi89161205r_36743315
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- TATCACATTTTTTATAAAGTTAAAGCATTTCTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGCTGCCGTTTTATTTCCAGTCTCTACTCAGAGTAAGGGGGTAAATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	36843315	36875378	13	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0342

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information