HUGE

Gene/Protein Characteristic Table for KIAA0285

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07156
Accession No. :	AB006623
Description :	Transmembrane protein 24.
HUGO Gene Name :	C2CD2-like (C2CD2L)
Clone Name :	hh10127a [Vector Info]
Source :	Human adult brain
Note :	We replaced ha06864, former representative clones for KIAA0285 with hh10127a. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2838 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 860 bp

Genome contig ID gi51511727f_118383805
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TTGGAATTTAATTTATTAAAGTCAAATTGGAGTTT
Flanking genome sequence
(109233 - 109282)
----+----*----+----*----+----*----+----*----+----*
ATAAACTGGACAACTGGTTATCCTTTGAAAGGCAGTAGGCAGCCAGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 118483805 118493036 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O14523	100.0	C2 domain-conta...	Homo sapiens
XP_508807	99.7	transmembrane p...	Pan troglodytes
BAC76048	99.7	DLNB23 [Homo sa...	Homo sapiens
XP_001164505	99.4	transmembrane p...	Pan troglodytes
XP_001102496	98.2	transmembrane p...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ATGCTCCTGTCCACACTACTC
Primer_r	: GTTCACTATTTGGGCGATGCG
PCR product length	: 193 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	860 bp
Genome contig ID	gi51511727f_118383805
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTGGAATTTAATTTATTAAAGTCAAATTGGAGTTT
Flanking genome sequence (109233 - 109282)	----+--------+--------+--------+--------+----* ATAAACTGGACAACTGGTTATCCTTTGAAAGGCAGTAGGCAGCCAGGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	118483805	118493036	14	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0285

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information