| HUGE |
Gene/Protein Characteristic Table for KIAA0268 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05980 |
|---|---|
| Accession No. : | D87742 |
| Description : | Melanoma inhibitory activity protein 3 precursor. |
| HUGO Gene Name : | melanoma inhibitory activity family, member 3 (MIA3) |
| Clone Name : | ha07061 [Vector Info] |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5976 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2394 bp Genome contig ID gi89161185f_220769328 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TATATTCAGGTCTGAATTAAAGTTAAGTTAATCACFlanking genome sequence
(138645 - 138694) ----+----*----+----*----+----*----+----*----+----*
ACAGTGTTCAATTTAAGCTTCTTTAATGTTGATGAAAGGTATTTGTAGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 220869328 220907971 25 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1193 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : Genebridge 4 | |
| : ATCATCCCTCAGCCAAATCAC | |
| : ACACAGAATATACCACATCCC | |
| : 234 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |