HUGE

Gene/Protein Characteristic Table for KIAA0176

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05577
Accession No. :	D79998
Description :	BTB/POZ domain-containing protein KCTD2.
HUGO Gene Name :	potassium channel tetramerisation domain containing 2 (KCTD2)
Clone Name :	ha03941 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3635 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2837 bp

Genome contig ID gi51511734f_70455104
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TTTGTGTGAATAAAGATATGAAACTTCTGAATCTC
Flanking genome sequence
(118472 - 118521)
----+----*----+----*----+----*----+----*----+----*
AAGAACTGTGGTGTGTTTTCCATTACTGCAGTCTCCTGGTTCCCACTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 70554935 70573574 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14681	3.2e-87	100.0	BTB/POZ domain-...	Homo sapiens
AAI60142	1.1e-86	99.6	Potassium chann...	synthetic construct
XP_001138510	4.2e-86	99.2	potassium chann...	Pan troglodytes
XP_001092438	3e-85	98.1	similar to pota...	Macaca mulatta
XP_852044	1.5e-84	97.3	similar to Pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003131 76 169 PF02214 K+ channel tetramerisation

HMMSmart IPR000210 74 177 SM00225 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	76	169	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	74	177	SM00225	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GTAACTGCTCTTGGGGATGTC
Primer_r	: CAAACAGGAACAGAGGGTGCC
PCR product length	: 154 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2837 bp
Genome contig ID	gi51511734f_70455104
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTTGTGTGAATAAAGATATGAAACTTCTGAATCTC
Flanking genome sequence (118472 - 118521)	----+--------+--------+--------+--------+----* AAGAACTGTGGTGTGTTTTCCATTACTGCAGTCTCCTGGTTCCCACTGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	70554935	70573574	6	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0176

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information