HUGE |
Gene/Protein Characteristic Table for KIAA0166 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05777 |
---|---|
Accession No. : | D79988 |
Description : | Kinetochore-associated protein 1. |
HUGO Gene Name : | kinetochore associated 1 (KNTC1) |
Clone Name : | ha02362 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6942 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 149 bp Genome contig ID gi89161190f_121477762 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
ATTACCCCACATGTAATAAATAAAACAATATGAGCFlanking genome sequence
(199117 - 199166) ----+----*----+----*----+----*----+----*----+----*
ATAATTGCCCCATAAAGAACTCATGTCCTGAATTAATAAGTCTTTTCATT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 121577762 121676877 64 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2228 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 17 |
: Genebridge 4 | |
: AAGAGCATATGAACACGGGCC | |
: TCAGAATTTCACAGGGAGCAG | |
: 279 (0.5k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |