HUGE

Gene/Protein Characteristic Table for KIAA0165

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04916
Accession No. :	D79987
Description :	Separin.
HUGO Gene Name :	extra spindle pole bodies homolog 1 (S. cerevisiae) (ESPL1)
Clone Name :	ha02421 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6662 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 161 bp

Genome contig ID gi89161190f_51848384
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TGATTTAACCTCAGTATAATAAAGATACATCATTT
Flanking genome sequence
(125304 - 125353)
----+----*----+----*----+----*----+----*----+----*
AAACCCTGTTTTGCGTAGTTTATCTGAGAACATTTAAAGACACGGCATGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 51948384 51973686 31 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2093 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14674	100.0	Separin; Separa...	Homo sapiens
EAW96681	99.8	extra spindle p...	Homo sapiens
NP_036423	99.8	extra spindle p...	Homo sapiens
XP_001103494	96.0	similar to extr...	Macaca mulatta
EAW96682	99.8	extra spindle p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005314 1681 2042 PF03568 Peptidase C50

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005314	1681	2042	PF03568	Peptidase C50

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: AGAAGGAGGCTGAAGAGTTGC
Primer_r	: AAAAGGCAAACACAAAACAGC
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	161 bp
Genome contig ID	gi89161190f_51848384
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGATTTAACCTCAGTATAATAAAGATACATCATTT
Flanking genome sequence (125304 - 125353)	----+--------+--------+--------+--------+----* AAACCCTGTTTTGCGTAGTTTATCTGAGAACATTTAAAGACACGGCATGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	51948384	51973686	31	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0165

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information