| HUGE |
Gene/Protein Characteristic Table for KIAA0105 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07372 |
|---|---|
| Accession No. : | D14661 |
| Description : | Wilms' tumor 1-associating protein. |
| HUGO Gene Name : | Wilms tumor 1 associated protein (WTAP) |
| Clone Name : | ha00682 [Vector Info] |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 1622 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1042 bp Genome contig ID gi89161210f_159968610 PolyA signal sequence
(ATTAAA,-14) +----*----+----*----+----*----+----
GTATTGCACTCTTGATATTAAATTAAATGTGCCTTFlanking genome sequence
(121829 - 121878) ----+----*----+----*----+----*----+----*----+----*
GAAATAGTTGGTTTTTTTTTTTTTTTAAGTTCAAAGAATATTATGATGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 160068610 160090437 6 100.0 Perfect prediction ContigView(URL based/DAS) 6 r 51381790 51383302 1 96.0 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 192 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : Stanford G3 | |
| : ACCTCAAGCAAGTCCAGCAGC | |
| : AAGCAAGGGGAAGGGGAAAAG | |
| : 353 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |