HUGE

Gene/Protein Characteristic Table for KIAA0077

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06520
Accession No. :	D38521
Description :	Proteasome activator complex subunit 4.
HUGO Gene Name :	proteasome (prosome, macropain) activator subunit 4 (PSME4)
Clone Name :	ha00919 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6106 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 708 bp

Genome contig ID gi89161199r_53845511
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATGTGTGATTTTAAAAATAAACAGCAACAACAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAACCCTGACTGGCTGTTTTTTCCCTGTATTCTTTACAACTATTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 53945511 54051291 47 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1798 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14997	100.0	Proteasome acti...	Homo sapiens
XP_606554	97.4	proteasome (pro...	Bos taurus
EDL98046	96.0	rCG23342, isofo...	Rattus norvegicus
XP_001055468	96.0	similar to prot...	Rattus norvegicus
Q5SSW2	95.9	Proteasome acti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 1133 1170 PF02985 HEAT

IPR000357 1309 1345 PF02985 HEAT

IPR000357 1635 1671 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	1133	1170	PF02985	HEAT
IPR000357	1309	1345	PF02985	HEAT
IPR000357	1635	1671	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGCTGCTGGATTTAGGTGGTA
Primer_r	: CATCAGGTCATTGGTTAGGTT
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	708 bp
Genome contig ID	gi89161199r_53845511
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGTGTGATTTTAAAAATAAACAGCAACAACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACCCTGACTGGCTGTTTTTTCCCTGTATTCTTTACAACTATTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	53945511	54051291	47	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0077

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information