HUGE

Gene/Protein Characteristic Table for KIAA0045

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07212
Accession No. :	D28476
Description :	Probable E3 ubiquitin-protein ligase TRIP12.
HUGO Gene Name :	thyroid hormone receptor interactor 12 (TRIP12)
Clone Name :	ha00941 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6428 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 340 bp

Genome contig ID gi89161199r_230240174
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TCCAGGCTGGAACAATAAATGTGGCTGTGCAGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTCTGGGCTGTGTGTATCCATCTAGCTAAGTCTGCAGTTTTCTTTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 230340174 230494899 41 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14669	100.0	Probable E3 ubi...	Homo sapiens
XP_001138519	99.9	thyroid hormone...	Pan troglodytes
EAW70903	100.0	thyroid hormone...	Homo sapiens
EAW70908	99.7	thyroid hormone...	Homo sapiens
XP_850221	99.1	similar to thyr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032957	5.3e-13	30.5	KIAA1131
AB037741	2.9e-07	25.4	KIAA1320
AB046845	1e-06	25.4	KIAA1625
AB007899	1.4e-06	24.1	KIAA0439
D42055	1.6e-06	27.4	KIAA0093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004170 762 797 PF02825 WWE

IPR000569 1649 2005 PF00632 HECT

HMMSmart IPR000569 1616 2005 SM00119 HECT

ProfileScan IPR004170 762 849 PS50918 WWE

IPR000569 1608 2005 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004170	762	797	PF02825	WWE
IPR000569	1649	2005	PF00632	HECT
HMMSmart	IPR000569	1616	2005	SM00119	HECT
ProfileScan	IPR004170	762	849	PS50918	WWE
IPR000569	1608	2005	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TTTGATAATGAGCAGCAGAGG
Primer_r	: ATTACAGAGGGCAAGAAGTCA
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	340 bp
Genome contig ID	gi89161199r_230240174
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCAGGCTGGAACAATAAATGTGGCTGTGCAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCTGGGCTGTGTGTATCCATCTAGCTAAGTCTGCAGTTTTCTTTCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	230340174	230494899	41	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0045

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information