| HUGE |
Gene/Protein Characteristic Table for KIAA0040 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05581 |
|---|---|
| Accession No. : | D25539 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | ha01160 [Vector Info] |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4460 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3183 bp Genome contig ID gi89161185r_173292867 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
ATTGCAATGAAATAAAATTAAAGGTATACTAGCTCFlanking genome sequence
(99879 - 99830) ----+----*----+----*----+----*----+----*----+----*
AGCTATGTCTGCCATATTTCTTTTTTCTTTTTTTTTTTTTTTTTTTTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 173392746 173428456 4 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 164 aa
No significant homologues
No significant homologues
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : Stanford G3 | |
| : CTTTTGTGTGTGTTCGAA | |
| : CTTTCCCCATTGCTCCTT | |
| : 178 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |