HUGE

Gene/Protein Characteristic Table for KIAA0034

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04587
Accession No. :	D21260
Description :	Clathrin heavy chain 1.
HUGO Gene Name :
Clone Name :	ha00931 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6111 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 911 bp

Genome contig ID gi51511734f_54952103
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTACTCAAATTTAAAATAAATTACTGGACTGTGG
Flanking genome sequence
(174805 - 174854)
----+----*----+----*----+----*----+----*----+----*
AAATAACATAGAATTGAAGTTTTAATTAAATACCACTCAAACGAAAAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 55052103 55126906 32 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1685 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q00610	100.0	Clathrin heavy ...	Homo sapiens
XP_537700	99.9	similar to Clat...	Canis lupus fam...
Q68FD5	99.9	Clathrin heavy ...	Mus musculus
P49951	99.9	Clathrin heavy ...	Bos taurus
XP_001135961	99.9	clathrin heavy ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001473 29 66 PF01394 Clathrin propeller

IPR001473 70 104 PF01394 Clathrin propeller

IPR001473 112 143 PF01394 Clathrin propeller

IPR001473 158 197 PF01394 Clathrin propeller

IPR001473 208 244 PF01394 Clathrin propeller

IPR001473 263 298 PF01394 Clathrin propeller

IPR001473 306 340 PF01394 Clathrin propeller

IPR015348 341 364 PF09268 Clathrin

IPR000547 547 689 PF00637 Clathrin

IPR000547 696 838 PF00637 Clathrin

IPR000547 843 982 PF00637 Clathrin

IPR000547 989 1134 PF00637 Clathrin

IPR000547 1138 1279 PF00637 Clathrin

IPR000547 1284 1430 PF00637 Clathrin

IPR000547 1433 1576 PF00637 Clathrin

HMMSmart IPR000547 547 689 SM00299 Clathrin

IPR000547 696 838 SM00299 Clathrin

IPR000547 843 982 SM00299 Clathrin

IPR000547 989 1134 SM00299 Clathrin

IPR000547 1138 1279 SM00299 Clathrin

IPR000547 1284 1430 SM00299 Clathrin

IPR000547 1433 1592 SM00299 Clathrin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001473	29	66	PF01394	Clathrin propeller
IPR001473	70	104	PF01394	Clathrin propeller
IPR001473	112	143	PF01394	Clathrin propeller
IPR001473	158	197	PF01394	Clathrin propeller
IPR001473	208	244	PF01394	Clathrin propeller
IPR001473	263	298	PF01394	Clathrin propeller
IPR001473	306	340	PF01394	Clathrin propeller
IPR015348	341	364	PF09268	Clathrin
IPR000547	547	689	PF00637	Clathrin
IPR000547	696	838	PF00637	Clathrin
IPR000547	843	982	PF00637	Clathrin
IPR000547	989	1134	PF00637	Clathrin
IPR000547	1138	1279	PF00637	Clathrin
IPR000547	1284	1430	PF00637	Clathrin
IPR000547	1433	1576	PF00637	Clathrin
HMMSmart	IPR000547	547	689	SM00299	Clathrin
IPR000547	696	838	SM00299	Clathrin
IPR000547	843	982	SM00299	Clathrin
IPR000547	989	1134	SM00299	Clathrin
IPR000547	1138	1279	SM00299	Clathrin
IPR000547	1284	1430	SM00299	Clathrin
IPR000547	1433	1592	SM00299	Clathrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGCTTTGGAGCTTGTCTG
Primer_r	: ATGACCTGGATGAAATAG
PCR product length	: 116 bp
PCR conditions	: 95 °C15 sec52 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	911 bp
Genome contig ID	gi51511734f_54952103
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTACTCAAATTTAAAATAAATTACTGGACTGTGG
Flanking genome sequence (174805 - 174854)	----+--------+--------+--------+--------+----* AAATAACATAGAATTGAAGTTTTAATTAAATACCACTCAAACGAAAAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	55052103	55126906	32	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0034

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information