HUGE |
Gene/Protein Characteristic Table for KIAA0006 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04167 |
---|---|
Accession No. : | D25304 |
Description : | Rho guanine nucleotide exchange factor 6. |
HUGO Gene Name : | Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (ARHGEF6) |
Clone Name : | ha01154 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4804 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2480 bp Genome contig ID gi89161218r_135475374 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TCAATACATAAAAATAAACAGTGCTTTATAAAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTCTTTTGCTTCTTTTTTTGCTAGCCGGTGTGCAGAAAGATTTCTTGT
Features of the protein sequence |
Description | |
---|---|---|
Length: 773 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 161 | 211 | PD000066 | Src homology-3 |
FPrintScan | IPR003096 | 28 | 43 | PR00888 | SM22/calponin |
IPR003096 | 75 | 90 | PR00888 | SM22/calponin | |
IPR003096 | 96 | 110 | PR00888 | SM22/calponin | |
IPR001452 | 174 | 189 | PR00452 | Src homology-3 | |
IPR001452 | 191 | 200 | PR00452 | Src homology-3 | |
IPR001452 | 202 | 214 | PR00452 | Src homology-3 | |
HMMPfam | IPR001715 | 1 | 108 | PF00307 | Calponin-like actin-binding |
IPR001452 | 160 | 214 | PF00018 | Src homology-3 | |
IPR000219 | 242 | 417 | PF00621 | DH | |
IPR001849 | 447 | 545 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001715 | 1 | 103 | SM00033 | Calponin-like actin-binding |
IPR001452 | 160 | 215 | SM00326 | Src homology-3 | |
IPR000219 | 242 | 417 | SM00325 | DH | |
IPR001849 | 447 | 547 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001715 | 1 | 107 | PS50021 | Calponin-like actin-binding |
IPR001452 | 157 | 216 | PS50002 | Src homology-3 | |
IPR000219 | 238 | 418 | PS50010 | DH | |
IPR001849 | 440 | 545 | PS50003 | Pleckstrin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: X |
: Genebridge 4 | |
: AACGAAGCTTGTGCAGAGTG | |
: CCTCTACGGGCAGCAGTTTA | |
: 163 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |