KIAA1725

Product ID	ORK06992
Accession No	AB051512
Description	slingshot protein phosphatase 2
Clone name	pf00950
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8024 bp) Predicted protein sequence (1042 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1725 by Kazusa Mouse cDNA Project

Length: 8024 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4894 bp
Genome contig ID	gi51511734r_24877091
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGTTCTTGTTACAGATTGAATAAATTTTTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATGAAACGTGTACTTCATCAGATGCAACAAAGGAGGGAGGTGCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	24977091	24999491	3	100.0	Perfect prediction

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q76I76	100.0	Protein phospha...	Homo sapiens
EAW51211	100.0	slingshot homol...	Homo sapiens
BAG59076	99.8	unnamed protein...	Homo sapiens
XP_511379	98.8	slingshot 2 [Pa...	Pan troglodytes
XP_001111396	96.4	similar to slin...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037719	3.1e-14	25.7	KIAA1298
AB051487	0.00067	27.2	KIAA1700

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000340	1	64	PF00782	Protein-tyrosine phosphatase
ProfileScan	IPR000387	1	45	PS50056	Protein-tyrosine phosphatase
ProfileScan	IPR000340	1	66	PS50054	Protein-tyrosine phosphatase

Primer_f	ATGTGTACCCTGTGCTGTTGC
Primer_r	CCTCCTCACATTGGTTCATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ATGTGTACCCTGTGCTGTTGC
Primer_r	CCTCCTCACATTGGTTCATAC
PCR product length	131 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles