KIAA0539

Product ID	ORK07304
Accession No	AB011111
Description	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Clone name	pf00803
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7594 bp) Predicted protein sequence (2046 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA0539 by Kazusa Mouse cDNA Project
Note	We replaced hg04107, former representative clones for KIAA0539 with pf00803. (2002/5/10)

Length: 7594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1451 bp
Genome contig ID	gi51511750r_32507649
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTCCCCTTCCCTACCCAAATAAACCTTACAACGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCTTTGAGACTATCCTGAACTTGAAATCCCACGTTTAGATCCAAGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	r	32607649	32669654	34	99.6	Perfect prediction

Length: 2046 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF72943	100.0	C21orf108 [Homo...	Homo sapiens
O60287	100.0	Nucleolar pre-r...	Homo sapiens
EAX09876	99.9	hCG401196, isof...	Homo sapiens
XP_531425	98.8	nucleolar preri...	Pan troglodytes
XP_001498726	82.7	similar to Nucl...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GAGAGGAAGTGCTTTGTCAGG
Primer_r	GAACTACACTCAGATACAGCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 21

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAGAGGAAGTGCTTTGTCAGG
Primer_r	GAACTACACTCAGATACAGCG
PCR product length	142 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles