KIAA0994

Gene/Protein Characteristic Table for KIAA0994

Order Kazusa clone(s) from :

Product ID	ORK06263
Accession No	AB023211
Description	peptidyl arginine deiminase, type II
Clone name	hk07627
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4343 bp) Predicted protein sequence (686 aa)
Source	Human adult brain
Rouge ID	mKIAA0994 by Kazusa Mouse cDNA Project

Length: 4343 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2281 bp
Genome contig ID	gi89161185r_17165844
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAGAACAATGAAATAAATGGTCCAAGGGGAAGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGGCTGTTGGTGTGATGTTCTTTGCTGCTTCATAGACACGGCCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	17265844	17318517	16	99.4	Perfect prediction

Features of the protein sequence

Description

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513113	100.0	peptidyl argini...	Pan troglodytes
XP_001099772	98.3	peptidyl argini...	Macaca mulatta
Q9Y2J8	100.0	Protein-arginin...	Homo sapiens
BAA82557	99.8	peptidylarginin...	Homo sapiens
BAD16624	93.2	peptidylarginin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013732	22	135	PF08526	Protein-arginine deiminase (PAD) N-terminal
	IPR013733	137	295	PF08527	Protein-arginine deiminase (PAD) central region
	IPR013530	300	686	PF03068	Protein-arginine deiminase

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTTCCTGCTTCCACCTTGATG
Primer_r	CATTGTTCTTTAGTCGAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTTCCTGCTTCCACCTTGATG
Primer_r	CATTGTTCTTTAGTCGAGCTC
PCR product length	153 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp