Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05728 |
---|---|
Accession No | AB067506 |
Description | KIAA1919 |
Clone name | hj08057 |
Vector information | |
cDNA sequence | DNA sequence (5261 bp) Predicted protein sequence (403 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4047 bp |
---|---|
Genome contig ID | gi89161210f_111593802 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105263 - 105312) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 111693802 | 111699063 | 1 | 99.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR011701 | 78 | 263 | PF07690 | Major facilitator superfamily MFS_1 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 9 | ALHFSFALGAFLAPLLAKLALGP | 31 | SECONDARY | 23 | 2 | 69 | WAYAVIGTYMFLVSVIFFCLFLK | 91 | PRIMARY | 23 | 3 | 110 | KYHNALLCLLFLFFFFYVGAEVT | 132 | PRIMARY | 23 | 4 | 153 | AGLNSIFWGTFAACRGLAIFFAT | 175 | SECONDARY | 23 | 5 | 180 | GTMIVLSNIGSLTSSLFLVLFDK | 202 | SECONDARY | 23 | 6 | 209 | IATSVYGASMATTFPSGVSWIEQ | 231 | SECONDARY | 23 | 7 | 239 | SAAFFVIGASLGEMAIPAVIGIL | 261 | SECONDARY | 23 | 8 | 271 | VLYTSLGASIATGILFPVLYKLA | 293 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GACAGAAAGAGTGAGGACCAG |
---|---|
Primer_r | GATTATAGACTTCAGCTGTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |