KIAA0945

Product ID	ORK01615
Accession No	AB023162
Description	bromo adjacent homology domain containing 1, transcript variant 1
Clone name	hj04760
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4696 bp) Predicted protein sequence (797 aa)
HaloTag ORF Clone	FHC01615
Flexi ORF Clone	FXC01615
Source	Human adult brain
Rouge ID	mKIAA0945 by Kazusa Mouse cDNA Project

Length: 4696 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2097 bp
Genome contig ID	gi51511731f_38419212
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- GAAAAAAATAAATTTGAGAAATTGTATTGATTTAG
Flanking genome sequence (128510 - 128559)	----+--------+--------+--------+--------+----* AAAAGGATCGTTTCCTGTGTGTCCTGTCATCTTTTGGTGTGTGGGTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	38519212	38547720	7	99.2	Perfect prediction

Length: 797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09910	100.0	bromo adjacent ...	synthetic construct
EAW92418	99.9	bromo adjacent ...	Homo sapiens
Q8TBE0	99.7	Bromo adjacent ...	Homo sapiens
AAH22782	99.7	Bromo adjacent ...	Homo sapiens
XP_001096466	98.3	similar to brom...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	641	737	PF01426	Bromo adjacent region
HMMSmart	IPR001025	641	796	SM00439	Bromo adjacent region
ProfileScan	IPR001025	641	796	PS51038	Bromo adjacent region

Primer_f	TAAATGAGGTTGGCAGAGTGG
Primer_r	GCATTTAAGTTCGGGGCAGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TAAATGAGGTTGGCAGAGTGG
Primer_r	GCATTTAAGTTCGGGGCAGCC
PCR product length	163 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles