KIAA0436

Product ID	ORK00536
Accession No	AB007896
Description	prolyl endopeptidase-like, transcript variant 6
Clone name	hj00011
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4661 bp) Predicted protein sequence (689 aa)
HaloTag ORF Clone	FHC00536
Flexi ORF Clone	FXC00536
Source	Human adult brain
Rouge ID	mKIAA0436 by Kazusa Mouse cDNA Project

Length: 4661 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2591 bp
Genome contig ID	gi89161199r_44299407
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TATATTTTGTCTGCTATTAAATACTTCCAAGCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTGTAATTTTATTTTTTATTCAATTACAAGAATACATACTATAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	44399407	44442127	14	99.4	Perfect prediction

Length: 689 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q4J6C6	99.8	Prolyl endopept...	Homo sapiens
XP_001144400	99.7	similar to prol...	Pan troglodytes
BAD18608	99.5	unnamed protein...	Homo sapiens
AAI43062	99.5	Prolyl endopept...	synthetic construct
XP_001111959	98.9	similar to prol...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002470	435	453	PR00862	Peptidase S9A
	IPR002470	461	485	PR00862	Peptidase S9A
	IPR002470	489	508	PR00862	Peptidase S9A
	IPR002470	519	539	PR00862	Peptidase S9A
	IPR002470	578	593	PR00862	Peptidase S9A
	IPR002470	596	618	PR00862	Peptidase S9A
HMMPfam	IPR004106	39	393	PF02897	Peptidase S9A
HMMPfam	IPR001375	450	612	PF00326	Peptidase S9

Primer_f	ACTTACCGGGCACTTCTTATG
Primer_r	TGTTCTTTAGGGGTAGGTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTTACCGGGCACTTCTTATG
Primer_r	TGTTCTTTAGGGGTAGGTTCC
PCR product length	204 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles