Order Kazusa clone(s) from : ![]() |
Product ID | ORK07156 |
---|---|
Accession No | AB006623 |
Description | C2CD2-like |
Clone name | hh10127a |
Vector information | |
cDNA sequence | DNA sequence (2838 bp) Predicted protein sequence (658 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0285
by Kazusa Mouse cDNA Project
|
Note | We replaced ha06864, former representative clones for KIAA0285 with hh10127a. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 860 bp |
---|---|
Genome contig ID | gi51511727f_118383805 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (109233 - 109282) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 118483805 | 118493036 | 14 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | test |
Panel name | Genebridge 4 |
---|---|
Primer_f | ATGCTCCTGTCCACACTACTC |
Primer_r | GTTCACTATTTGGGCGATGCG |
PCR product length | 193 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |