KIAA1284

Product ID	ORK00797
Accession No	AB033110
Description	inturned planar cell polarity protein
Clone name	hh09454s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (3238 bp) Predicted protein sequence (953 aa)
HaloTag ORF Clone	FHC00797
Flexi ORF Clone	FXC00797
Source	Human adult brain
Rouge ID	mKIAA1284 by Kazusa Mouse cDNA Project
Note	We replaced hh09454, former representative clones for KIAA1284 with hh09454s1. (2002/5/10)

Length: 3238 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	339 bp
Genome contig ID	gi89161207f_128673570
PolyA signal sequence (AATATA,-29)	+--------+--------+----*----+---- CAGATTAATATAGGAAATGTTTATTCTTGAAAAAT
Flanking genome sequence (183812 - 183861)	----+--------+--------+--------+--------+----* ACTCAATTTGTTGTTGTTTATTTTTCTCAAAATTCATACTGATATCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	128773570	128857380	16	99.8	Perfect prediction

Length: 953 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD6	100.0	PDZ domain-cont...	Homo sapiens
XP_001156541	99.0	PDZ domain cont...	Pan troglodytes
XP_001104977	97.9	similar to PDZ ...	Macaca mulatta
XP_848650	88.7	similar to PDZ ...	Canis lupus fam...
XP_001501819	88.0	inturned planar...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001478	194	276	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	196	274	PS50106	PDZ/DHR/GLGF

Primer_f	CAGATAGCTTGACCACTTCGC
Primer_r	AACCATTGTCAGATCCTCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGATAGCTTGACCACTTCGC
Primer_r	AACCATTGTCAGATCCTCCAC
PCR product length	156 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles